Online Inquiry
PARP1 Knockout Cell Line
SPL-02444
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 268bp insertion |
| Target Information | |
|---|---|
| Target Name | PARP |
| Gene Abbr. | PARP1 |
| Gene ID | 142 |
| Full Name | poly(ADP-ribose) polymerase 1 |
| Alias | ADPRT, ADPRT 1, ADPRT1, ARTD1, PARP |
| Species | Human |
| Genomic Locus | chr1:226402354 |
| Transcript | NM_001618 |
| WT Expression Level | 255.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 268bp insertion in a coding exon of PARP1. |
| Description | 268bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGACTTTTCCATCAAACAT |
| PCR Primer |
Forward: GTATGTACACACCTGTCACTCCTC Reverse: CAAAAGTTTCATGTGCTATCCCACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.