Online Inquiry
Parp1 cDNA ORF Clone, Mouse, C-His tag
SPD-11139
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | PARP |
Gene Abbr. | Parp1 |
Gene ID | 11545 |
Full Name | poly (ADP-ribose) polymerase family, member 1 |
Alias | 5830444G22Rik, A, AI893648, ARTD1, Adp |
Introduction | PARP, a 116 kDa nuclear poly (ADP-ribose) polymerase, appears to be involved in DNA repair in response to environmental stress. This protein can be cleaved by many ICE-like caspases in vitro and is one of the main cleavage targets of caspase-3 in vivo. In human PARP, the cleavage occurs between Asp214 and Gly215, which separates the PARP amino-terminal DNA binding domain (24 kDa) from the carboxy-terminal catalytic domain (89 kDa). PARP helps cells to maintain their viability; cleavage of PARP facilitates cellular disassembly and serves as a marker of cells undergoing apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 with C terminal His tag. |
NCBI Ref Seq | NM_007415.2 |
RefSeq ORF Size | 3045 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.