Parp1 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Parp1 cDNA ORF Clone, Mouse, C-FLAG tag

Parp1 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-11138

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 with C terminal Flag tag.
Target Information
Species Mouse
Target Name PARP
Gene Abbr. Parp1
Gene ID 11545
Full Name poly (ADP-ribose) polymerase family, member 1
Alias 5830444G22Rik, A, AI893648, ARTD1, Adp
Introduction PARP, a 116 kDa nuclear poly (ADP-ribose) polymerase, appears to be involved in DNA repair in response to environmental stress. This protein can be cleaved by many ICE-like caspases in vitro and is one of the main cleavage targets of caspase-3 in vivo. In human PARP, the cleavage occurs between Asp214 and Gly215, which separates the PARP amino-terminal DNA binding domain (24 kDa) from the carboxy-terminal catalytic domain (89 kDa). PARP helps cells to maintain their viability; cleavage of PARP facilitates cellular disassembly and serves as a marker of cells undergoing apoptosis.
Product Details
Description Full length Clone DNA of Mouse poly (ADP-ribose) polymerase family, member 1 with C terminal Flag tag.
NCBI Ref Seq NM_007415.2
RefSeq ORF Size 3045 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.