Online Inquiry
PAK2 cDNA ORF Clone, Human, N-FLAG tag
SPD-11082
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 2 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PAK |
| Gene Abbr. | PAK2 |
| Gene ID | 5062 |
| Full Name | p21 (RAC1) activated kinase 2 |
| Alias | PAK65, PAKgamma |
| Introduction | The p21-activated kinase (PAK) family of serine/threonine kinases is engaged in multiple cellular processes, including cytoskeletal reorganization, MAPK signaling, apoptotic signaling, control of phagocyte NADPH oxidase, and growth factor-induced neurite outgrowth. Several mechanisms that induce PAK activity have been reported. Binding of Rac/Cdc42 to the CRIB (or PBD) domain near the amino terminus of PAK causes autophosphorylation and conformational changes in PAK. Phosphorylation of PAK1 at Thr423 by PDK induces activation of PAK1. Several autophosphorylation sites have been identified, including Ser199 and Ser204 of PAK1, and Ser192 and Ser197 of PAK2. Because the autophosphorylation sites are located in the amino-terminal inhibitory domain, it has been hypothesized that modification in this region prevents the kinase from reverting to an inactive conformation. Research indicates that phosphorylation at Ser144 of PAK1 or Ser139 of PAK3 (located in the kinase inhibitory domain) affects kinase activity. Phosphorylation at Ser21 of PAK1 or Ser20 of PAK2 regulates binding with the adaptor protein Nck. PAK4, PAK5/7, and PAK6 have lower sequence similarity with PAK1-3 in the amino-terminal regulatory region. Phosphorylation at Ser474 of PAK4, a site analogous to Thr423 of PAK1, may play a pivotal role in regulating the activity and function of PAK4. PAK family members are widely expressed, and often overexpressed in human cancer. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 2 with N terminal Flag tag. |
| NCBI Ref Seq | NM_002577.4 |
| RefSeq ORF Size | 1614 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.61kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.