PAK1 Knockout Cell Line - CD BioSciences

service-banner

PAK1 Knockout Cell Line

PAK1 Knockout Cell Line

SPL-02438

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name PAK
Gene Abbr. PAK1
Gene ID 5058
Full Name p21 (RAC1) activated kinase 1
Alias IDDMSSD, PAKalpha, alpha-PAK, p65-PAK
Species Human
Genomic Locus chr11:77392343
Transcript NM_002576
WT Expression Level 44.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PAK1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence GTAAAATGGATCGGTAAAAT
PCR Primer Forward: ACAGATCTTTTATCCAGGTTACCCA
Reverse: GAAATACCAGCACTATGATTGGAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.