OTUD5 Knockout Cell Line - CD BioSciences

service-banner

OTUD5 Knockout Cell Line

OTUD5 Knockout Cell Line

SPL-02415

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name OTUD5
Gene Abbr. OTUD5
Gene ID 55593
Full Name OTU deubiquitinase 5
Alias DUBA
Species Human
Genomic Locus chrX:48934965
Transcript NM_001136157
WT Expression Level 67.58 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the OTU (ovarian tumor) domain-containing cysteine protease superfamily. The OTU domain confers deubiquitinase activity and the encoded protein has been shown to suppress the type I interferon-dependent innate immune response by cleaving the polyubiquitin chain from an essential type I interferon adaptor protein. Cleavage results in disassociation of the adaptor protein from a downstream signaling complex and disruption of the type I interferon signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of OTUD5.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence GGTTGTGCGAAAGCATTGCA
PCR Primer Forward: CCTCCCCAAAGGATGTTCTATGATT
Reverse: TGTGACATAGTTGGAGAAGTAGTCG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.