Online Inquiry
OTUD1 Knockout Cell Line
SPL-02411
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 50bp deletion |
| Target Information | |
|---|---|
| Target Name | OTUD1 |
| Gene Abbr. | OTUD1 |
| Gene ID | 220213 |
| Full Name | OTU deubiquitinase 1 |
| Alias | DUBA7, OTDC1 |
| Species | Human |
| Genomic Locus | chr10:23440427 |
| Transcript | NM_001145373 |
| WT Expression Level | 1.84 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Deubiquitinating enzymes (DUBs; see MIM 603478) are proteases that specifically cleave ubiquitin (MIM 191339) linkages, negating the action of ubiquitin ligases. DUBA7 belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain.[supplied by OMIM, May 2008]. COMPLETENESS: complete on the 3' end. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 50bp deletion in a coding exon of OTUD1. |
| Description | 50bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGTCAGCAAGACGGTGTA |
| PCR Primer |
Forward: AGCCGGTGATCGTCTCCA Reverse: CAAATACAGCATCATAGTGTCCGTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.