OTUB2 Knockout Cell Line - CD BioSciences

service-banner

OTUB2 Knockout Cell Line

OTUB2 Knockout Cell Line

SPL-02409

Size Price
1 Unit Online Inquiry
Description
22bp deletion
Target Information
Target Name Otubain-2
Gene Abbr. OTUB2
Gene ID 78990
Full Name OTU deubiquitinase, ubiquitin aldehyde binding 2
Alias C14orf137, OTB2, OTU2
Species Human
Genomic Locus chr14:94037429
Transcript NM_023112
WT Expression Level 1.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes one of several deubiquitylating enzymes. Ubiquitin modification of proteins is needed for their stability and function; to reverse the process, deubiquityling enzymes remove ubiquitin. This protein contains an OTU domain and binds Ubal (ubiquitin aldehyde); an active cysteine protease site is present in the OTU domain. [provided by RefSeq, Aug 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of OTUB2.
Description 22bp deletion
Parental Cell Line C631
Guide RNA Sequence TTCAGGATGGTCCCGAAGAA
PCR Primer Forward: GATTTATCGCTAAGGCAAATGTCCA
Reverse: GGAAGGTCTCATTCATTGTTGTCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.