Online Inquiry
OGG1 Knockout Cell Line
SPL-02375
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | OGG1 |
Gene Abbr. | OGG1 |
Gene ID | 4968 |
Full Name | 8-oxoguanine DNA glycosylase |
Alias | HMMH, HOGG1, MUTM, OGH1 |
Species | Human |
Genomic Locus | chr3:9750311 |
Transcript | NM_016828 |
WT Expression Level | 15.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of OGG1. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTACGATGCCCCATGCGCCT |
PCR Primer |
Forward: GAGGTGGAGGAATTAAGTGAAACAG Reverse: GTTTCTTCCATCATCCCCCAAATTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 ml of pre-warmed media in a 10cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.