Online Inquiry
OCRL Knockout Cell Line
SPL-02371
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | OCRL |
| Gene Abbr. | OCRL |
| Gene ID | 4952 |
| Full Name | OCRL inositol polyphosphate-5-phosphatase |
| Alias | Dent-2, INPP5F, LOCR, NPHL2, OCRL-1 |
| Species | Human |
| Genomic Locus | chrX:129557326 |
| Transcript | NM_001587 |
| WT Expression Level | 31.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an inositol polyphosphate 5-phosphatase. This protein is involved in regulating membrane trafficking and is located in numerous subcellular locations including the trans-Golgi network, clathrin-coated vesicles and, endosomes and the plasma membrane. This protein may also play a role in primary cilium formation. Mutations in this gene cause oculocerebrorenal syndrome of Lowe and also Dent disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of OCRL. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGCTGCAAAATTCGGGTTC |
| PCR Primer |
Forward: ACTCTCTTGATCTTGTATGTGTGCT Reverse: ATTCCACTCCCGTTGAAATAGAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.