OCRL Knockout Cell Line - CD BioSciences

service-banner

OCRL Knockout Cell Line

OCRL Knockout Cell Line

SPL-02370

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name OCRL
Gene Abbr. OCRL
Gene ID 4952
Full Name OCRL inositol polyphosphate-5-phosphatase
Alias Dent-2, INPP5F, LOCR, NPHL2, OCRL-1
Species Human
Genomic Locus chrX:129557326
Transcript NM_001587
WT Expression Level 31.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an inositol polyphosphate 5-phosphatase. This protein is involved in regulating membrane trafficking and is located in numerous subcellular locations including the trans-Golgi network, clathrin-coated vesicles and, endosomes and the plasma membrane. This protein may also play a role in primary cilium formation. Mutations in this gene cause oculocerebrorenal syndrome of Lowe and also Dent disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of OCRL.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TGGCTGCAAAATTCGGGTTC
PCR Primer Forward: ACTCTCTTGATCTTGTATGTGTGCT
Reverse: ATTCCACTCCCGTTGAAATAGAAGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.