Online Inquiry
OBSCN Knockout Cell Line
SPL-02369
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
62bp deletion |
Target Information | |
---|---|
Target Name | OBSCN |
Gene Abbr. | OBSCN |
Gene ID | 84033 |
Full Name | obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |
Alias | ARHGEF30, UNC89 |
Species | Human |
Genomic Locus | chr1:228211931 |
Transcript | NM_052843 |
WT Expression Level | 0.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 720 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein belongs to the family of giant sacromeric signaling proteins that includes titin and nebulin, and may have a role in the organization of myofibrils during assembly and may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 62bp deletion in a coding exon of OBSCN. |
Description | 62bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AAGCGCGCGCCGGCCGCCAC |
PCR Primer |
Forward: AAATAGGATGTGTGGAGGTGTTGAA Reverse: AGGCCTCGCCTATGGCATT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.