Online Inquiry
NUSAP1 Knockout Cell Line
SPL-02364
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 64bp insertion |
| Target Information | |
|---|---|
| Target Name | NUSAP1 |
| Gene Abbr. | NUSAP1 |
| Gene ID | 51203 |
| Full Name | nucleolar and spindle associated protein 1 |
| Alias | ANKT, BM037, LNP, NUSAP, PRO0310p1 |
| Species | Human |
| Genomic Locus | chr15:41351090 |
| Transcript | NM_018454 |
| WT Expression Level | 201.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 64bp insertion in a coding exon of NUSAP1. |
| Description | 64bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTTCTTGGTGCTCGTCTGG |
| PCR Primer |
Forward: TTGTCCTTGCTAACAGAGCTAATCT Reverse: CCAGCCTCTAGAACTATGAAAGAGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.