NSD3 Knockout Cell Line - CD BioSciences

service-banner

NSD3 Knockout Cell Line

NSD3 Knockout Cell Line

SPL-02352

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name NSD3
Gene Abbr. NSD3
Gene ID 54904
Full Name nuclear receptor binding SET domain protein 3
Alias KMT3F, KMT3G, WHISTLE, WHSC1L1, pp14328
Species Human
Genomic Locus chr8:38347948
Transcript NM_023034
WT Expression Level 32.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is related to the Wolf-Hirschhorn syndrome candidate-1 gene and encodes a protein with PWWP (proline-tryptophan-tryptophan-proline) domains. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. Two alternatively spliced variants have been described. [provided by RefSeq, May 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of WHSC1L1.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence GATGGATACCCATTTGTGAG
PCR Primer Forward: TCTTCTTTGGAATCACAGTTTGTGG
Reverse: CCCCTCTTTTATAATTTTAGGCCCG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.