Online Inquiry
NSD3 Knockout Cell Line
SPL-02351
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | NSD3 |
| Gene Abbr. | NSD3 |
| Gene ID | 54904 |
| Full Name | nuclear receptor binding SET domain protein 3 |
| Alias | KMT3F, KMT3G, WHISTLE, WHSC1L1, pp14328 |
| Species | Human |
| Genomic Locus | chr8:38347948 |
| Transcript | NM_023034 |
| WT Expression Level | 32.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is related to the Wolf-Hirschhorn syndrome candidate-1 gene and encodes a protein with PWWP (proline-tryptophan-tryptophan-proline) domains. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. Two alternatively spliced variants have been described. [provided by RefSeq, May 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of WHSC1L1. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATGGATACCCATTTGTGAG |
| PCR Primer |
Forward: TCTTCTTTGGAATCACAGTTTGTGG Reverse: CCCCTCTTTTATAATTTTAGGCCCG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.