NSD1 Knockout Cell Line - CD BioSciences

service-banner

NSD1 Knockout Cell Line

NSD1 Knockout Cell Line

SPL-02347

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name NSD1
Gene Abbr. NSD1
Gene ID 64324
Full Name nuclear receptor binding SET domain protein 1
Alias ARA267, KMT3B, SOTOS, SOTOS1, STO
Species Human
Genomic Locus chr5:177191942
Transcript NM_022455
WT Expression Level 24.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of NSD1.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence CAAAATTCAAGAGACGCCCA
PCR Primer Forward: TCATACATTGCTTTTTCAGAAGGCT
Reverse: CACCAATTCATTCACAAAATGTTCCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.