NRP1 Knockout Cell Line - CD BioSciences

service-banner

NRP1 Knockout Cell Line

NRP1 Knockout Cell Line

SPL-02343

Size Price
1 Unit Online Inquiry
Description
74bp deletion
Target Information
Target Name NRP1
Gene Abbr. NRP1
Gene ID 8829
Full Name neuropilin 1
Alias BDCA4, CD304, NP1, NRP, VEGF165R
Species Human
Genomic Locus chr10:33330828
Transcript NM_003873
WT Expression Level 22.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 74bp deletion in a coding exon of NRP1.
Description 74bp deletion
Parental Cell Line C631
Guide RNA Sequence CCAGGAGATGTAAGGTACCC
PCR Primer Forward: CCCTGTTCAAAAACATTCCCACTTA
Reverse: GAGTCAACCTTCCTGAGATCAAAGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.