Online Inquiry
NRP1 Knockout Cell Line
SPL-02343
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 74bp deletion |
| Target Information | |
|---|---|
| Target Name | NRP1 |
| Gene Abbr. | NRP1 |
| Gene ID | 8829 |
| Full Name | neuropilin 1 |
| Alias | BDCA4, CD304, NP1, NRP, VEGF165R |
| Species | Human |
| Genomic Locus | chr10:33330828 |
| Transcript | NM_003873 |
| WT Expression Level | 22.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 74bp deletion in a coding exon of NRP1. |
| Description | 74bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCAGGAGATGTAAGGTACCC |
| PCR Primer |
Forward: CCCTGTTCAAAAACATTCCCACTTA Reverse: GAGTCAACCTTCCTGAGATCAAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.