Nras cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Nras cDNA ORF Clone, Rat, untagged

Nras cDNA ORF Clone, Rat, untagged

SPD-10812

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat neuroblastoma ras oncogene.
Target Information
Species Rat
Target Name NRAS
Gene Abbr. Nras
Gene ID 24605
Full Name NRAS proto-oncogene, GTPase
Product Details
Description Full length Clone DNA of Rat neuroblastoma ras oncogene.
NCBI Ref Seq NM_080766.2
RefSeq ORF Size 570 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.