Online Inquiry
Nr4a1 cDNA ORF Clone, Mouse, N-His tag
SPD-10828
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse nuclear receptor subfamily 4, group A, member 1 with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Nur77 |
| Gene Abbr. | Nr4a1 |
| Gene ID | 15370 |
| Full Name | nuclear receptor subfamily 4, group A, member 1 |
| Alias | GFR, GFRP1, Gf, Gfrp, Hbr |
| Introduction | Nur77, also known as TR3 and NGFI-B, is an immediate-early response gene and an orphan member of the steroid/thyroid/retinoid receptor superfamily. Nur77 is composed of an amino-terminal transactivation domain, a central DNA-binding domain and a carboxy-terminal ligand-binding domain. Expression of Nur77 is rapidly induced by a variety of stimuli, including apoptotic, mitogenic and stress signals. It has been proposed to have many functions related to cell proliferation, differentiation and apoptosis. Nur77 has been extensively studied in T cells where it has been implicated in the process of negative selection and TCR-mediated apoptosis. Nur77 binds to specific DNA elements leading to the regulation of target genes. As a possible mechanism for regulating apoptosis, Nur77 can induce the expression of apoptotic genes such as FasL and TRAIL. Nur77 is heavily phosphorylated by multiple kinases, which may affect its transactivation activity as well as its subcellular localization. Translocation of Nur77 from the nucleus to the mitochondria can regulate its association with Bcl-2 and control the release of cytochrome c, thereby triggering apoptosis.Phosphorylation of Nur77 by Akt or RSK occurs at Ser351 (corresponding to rat Nur77 Ser350 and Ser354 of mouse Nur77), a site within the Nur77 DNA binding domain. Serine phosphorylation at this site can down regulate transcriptional activity of Nur77. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse nuclear receptor subfamily 4, group A, member 1 with N terminal His tag. |
| NCBI Ref Seq | NM_010444.2 |
| RefSeq ORF Size | 1806 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.