Nr4a1 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Nr4a1 cDNA ORF Clone, Mouse, N-HA tag

Nr4a1 cDNA ORF Clone, Mouse, N-HA tag

SPD-10830

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse nuclear receptor subfamily 4, group A, member 1 with N terminal HA tag.
Target Information
Species Mouse
Target Name Nur77
Gene Abbr. Nr4a1
Gene ID 15370
Full Name nuclear receptor subfamily 4, group A, member 1
Alias GFR, GFRP1, Gf, Gfrp, Hbr
Introduction Nur77, also known as TR3 and NGFI-B, is an immediate-early response gene and an orphan member of the steroid/thyroid/retinoid receptor superfamily. Nur77 is composed of an amino-terminal transactivation domain, a central DNA-binding domain and a carboxy-terminal ligand-binding domain. Expression of Nur77 is rapidly induced by a variety of stimuli, including apoptotic, mitogenic and stress signals. It has been proposed to have many functions related to cell proliferation, differentiation and apoptosis. Nur77 has been extensively studied in T cells where it has been implicated in the process of negative selection and TCR-mediated apoptosis. Nur77 binds to specific DNA elements leading to the regulation of target genes. As a possible mechanism for regulating apoptosis, Nur77 can induce the expression of apoptotic genes such as FasL and TRAIL. Nur77 is heavily phosphorylated by multiple kinases, which may affect its transactivation activity as well as its subcellular localization. Translocation of Nur77 from the nucleus to the mitochondria can regulate its association with Bcl-2 and control the release of cytochrome c, thereby triggering apoptosis.Phosphorylation of Nur77 by Akt or RSK occurs at Ser351 (corresponding to rat Nur77 Ser350 and Ser354 of mouse Nur77), a site within the Nur77 DNA binding domain. Serine phosphorylation at this site can down regulate transcriptional activity of Nur77.
Product Details
Description Full length Clone DNA of Mouse nuclear receptor subfamily 4, group A, member 1 with N terminal HA tag.
NCBI Ref Seq NM_010444.2
RefSeq ORF Size 1806 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.