NR4A1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

NR4A1 cDNA ORF Clone, Human, C-FLAG tag

NR4A1 cDNA ORF Clone, Human, C-FLAG tag

SPD-10833

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human nuclear receptor subfamily 4, group A, member 1
Target Information
Species Human
Target Name Nur77
Gene Abbr. NR4A1
Gene ID 3164
Full Name nuclear receptor subfamily 4 group A member 1
Alias GFRP1, HMR, N10, NAK-1, NGFIB
Introduction Nur77, also known as TR3 and NGFI-B, is an immediate-early response gene and an orphan member of the steroid/thyroid/retinoid receptor superfamily. Nur77 is composed of an amino-terminal transactivation domain, a central DNA-binding domain and a carboxy-terminal ligand-binding domain. Expression of Nur77 is rapidly induced by a variety of stimuli, including apoptotic, mitogenic and stress signals. It has been proposed to have many functions related to cell proliferation, differentiation and apoptosis. Nur77 has been extensively studied in T cells where it has been implicated in the process of negative selection and TCR-mediated apoptosis. Nur77 binds to specific DNA elements leading to the regulation of target genes. As a possible mechanism for regulating apoptosis, Nur77 can induce the expression of apoptotic genes such as FasL and TRAIL. Nur77 is heavily phosphorylated by multiple kinases, which may affect its transactivation activity as well as its subcellular localization. Translocation of Nur77 from the nucleus to the mitochondria can regulate its association with Bcl-2 and control the release of cytochrome c, thereby triggering apoptosis.Phosphorylation of Nur77 by Akt or RSK occurs at Ser351 (corresponding to rat Nur77 Ser350 and Ser354 of mouse Nur77), a site within the Nur77 DNA binding domain. Serine phosphorylation at this site can down regulate transcriptional activity of Nur77.
Product Details
Description Full length Clone DNA of Human nuclear receptor subfamily 4, group A, member 1
NCBI Ref Seq NM_001202233.1
RefSeq ORF Size 1875 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV mammalian cell promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.88kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.