Online Inquiry
NR3C2 Knockout Cell Line
SPL-02323
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
194bp insertion |
Target Information | |
---|---|
Target Name | NR3C2 |
Gene Abbr. | NR3C2 |
Gene ID | 4306 |
Full Name | nuclear receptor subfamily 3 group C member 2 |
Alias | MCR, MLR, MR, NR3C2VIT |
Species | Human |
Genomic Locus | chr4:148436327 |
Transcript | NM_000901 |
WT Expression Level | 1.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 194bp insertion in a coding exon of NR3C2. |
Description | 194bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCGCATGACGCCACCATTCA |
PCR Primer |
Forward: GATTTTCAACATTAGGGGAGCATGT Reverse: AGAGATGCTGACTATTCCTATGAGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.