Online Inquiry
NR2C2 cDNA ORF Clone, Human, N-His tag
SPD-15120
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human nuclear receptor subfamily 2, group C, member 2 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TR4/NR2C2 |
Gene Abbr. | NR2C2 |
Gene ID | 7182 |
Full Name | nuclear receptor subfamily 2 group C member 2 |
Alias | TAK1, TR4 |
Introduction | Members of the nuclear hormone receptor family, such as NR2C2, act as ligand-activated transcription factors. The proteins have an N-terminal transactivation domain, a central DNA-binding domain with 2 zinc fingers, and a ligand-binding domain at the C terminus. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes (Yoshikawa et al., 1996 [PubMed 8661150]).[supplied by OMIM] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human nuclear receptor subfamily 2, group C, member 2 with N terminal His tag. |
NCBI Ref Seq | BC051670 |
RefSeq ORF Size | 1593 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.