Online Inquiry
NQO2 Knockout Cell Line
SPL-02319
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
11bp deletion |
Target Information | |
---|---|
Target Name | NQO2 |
Gene Abbr. | NQO2 |
Gene ID | 4835 |
Full Name | N-ribosyldihydronicotinamide:quinone reductase 2 |
Alias | DHQV, DIA6, NMOR2, QR2 |
Species | Human |
Genomic Locus | chr6:3012589 |
Transcript | NM_000904 |
WT Expression Level | 44.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of NQO2. |
Description | 11bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCTTTGCTTGTAGGCTTCGT |
PCR Primer |
Forward: CAGCAAATGTCTTTGACTTGTCTGA Reverse: AACCAGGTTACAATATTTGCTCAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.