NPL Knockout Cell Line - CD BioSciences

service-banner

NPL Knockout Cell Line

NPL Knockout Cell Line

SPL-02315

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name NPL
Gene Abbr. NPL
Gene ID 80896
Full Name N-acetylneuraminate pyruvate lyase
Alias C112, C1orf13, NAL, NPL1
Species Human
Genomic Locus chr1:182814783
Transcript NM_030769
WT Expression Level 4.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of NPL.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence GCCCAACATGCAGCAGAAAT
PCR Primer Forward: ATAAGATTAAGTGCACAGCTCACCT
Reverse: TTTTGAATGGAGGCAAGAAGAAGTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.