Online Inquiry
NLK cDNA ORF Clone, Human, N-HA tag
SPD-10791
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human nemo-like kinase with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | NLK |
Gene Abbr. | NLK |
Gene ID | 51701 |
Full Name | nemo like kinase |
Introduction | Nemo-like kinase (NLK ) is a serine/threonine-protein kinase that regulates multiple signaling pathways, including Wnt/β-catenin, TGFβ, IL-6, and Notch. NLK contributes to cell proliferation, differentiation, cell fate determination during early embryogenesis and nervous system development in vertebrates. Recent studies showed that NLK is aberrantly expressed in various types of cancer where it regulates cancer cell proliferation, migration, invasion and survival. NLK is localized predominantly in nucleus and at a lower level in cytoplasm. Homodimerization of NLK is required for its activation and nuclear localization. NLK is activated via intermolecular autophosphorylation at Thr286. NLK interacts with and phosphorylates a number of transcription factors including FOXO1, FOXO4, MYB, NOTCH1 and TCF7L2/TCF4, and LEF-1/TCF. NLK also associates with E3 ubiquitin ligase NARF and Raptor and regulates their function. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human nemo-like kinase with N terminal HA tag. |
NCBI Ref Seq | NM_016231.4 |
RefSeq ORF Size | 1584 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.