NLK cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

NLK cDNA ORF Clone, Human, C-FLAG tag

NLK cDNA ORF Clone, Human, C-FLAG tag

SPD-10783

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human nemo-like kinase with C terminal Flag tag.
Target Information
Species Human
Target Name NLK
Gene Abbr. NLK
Gene ID 51701
Full Name nemo like kinase
Introduction Nemo-like kinase (NLK ) is a serine/threonine-protein kinase that regulates multiple signaling pathways, including Wnt/β-catenin, TGFβ, IL-6, and Notch. NLK contributes to cell proliferation, differentiation, cell fate determination during early embryogenesis and nervous system development in vertebrates. Recent studies showed that NLK is aberrantly expressed in various types of cancer where it regulates cancer cell proliferation, migration, invasion and survival. NLK is localized predominantly in nucleus and at a lower level in cytoplasm. Homodimerization of NLK is required for its activation and nuclear localization. NLK is activated via intermolecular autophosphorylation at Thr286. NLK interacts with and phosphorylates a number of transcription factors including FOXO1, FOXO4, MYB, NOTCH1 and TCF7L2/TCF4, and LEF-1/TCF. NLK also associates with E3 ubiquitin ligase NARF and Raptor and regulates their function.
Product Details
Description Full length Clone DNA of Human nemo-like kinase with C terminal Flag tag.
NCBI Ref Seq NM_016231.4
RefSeq ORF Size 1623 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.62kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.