NHEJ1 Knockout Cell Line - CD BioSciences

service-banner

NHEJ1 Knockout Cell Line

NHEJ1 Knockout Cell Line

SPL-02283

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name NHEJ1
Gene Abbr. NHEJ1
Gene ID 79840
Full Name non-homologous end joining factor 1
Alias XLF
Species Human
Genomic Locus chr2:219157603
Transcript NM_024782
WT Expression Level 19.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Double-strand breaks in DNA result from genotoxic stresses and are among the most damaging of DNA lesions. This gene encodes a DNA repair factor essential for the nonhomologous end-joining pathway, which preferentially mediates repair of double-stranded breaks. Mutations in this gene cause different kinds of severe combined immunodeficiency disorders. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of NHEJ1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CGTCCTTCAACAATGGGCGA
PCR Primer Forward: TAAAAGCACCTAAAGCTTCCTCTCA
Reverse: AGTTTCCTTTTAGCACCCTTACTCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.