Nfkbib cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Nfkbib cDNA ORF Clone, Mouse, N-Myc tag

Nfkbib cDNA ORF Clone, Mouse, N-Myc tag

SPD-10720

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta with N terminal Myc tag.
Target Information
Species Mouse
Target Name NF-κB Inhibitor
Gene Abbr. Nfkbib
Gene ID 18036
Full Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Alias I(Kappa)B(beta), I-kappa-B-beta, IKB-beta, IKapp, IKappaBbeta
Introduction The NF-κB/Rel transcription factors are present in the cytosol in an inactive state complexed with the inhibitory IκB proteins. Activation occurs via phosphorylation of IκBα at Ser32 and Ser36 followed by proteasome-mediated degradation that results in the release and nuclear translocation of active NF-κB. IκBα phosphorylation and resulting Rel-dependent transcription are activated by a highly diverse group of extracellular signals including inflammatory cytokines, growth factors, and chemokines. Kinases that phosphorylate IκB at these activating sites have been identified.The regulation of IκBβ and IκBε is similar to that of IκBα. However, the phosphorylation and ubiquitin-mediated degradation of these proteins occurs with much slower kinetics. IKK phosphorylation of IκBβ occurs at Ser19 and Ser23, while IκBε can be phosphorylated at Ser18 and Ser22. The human sequence of IκB-β has also been reported to contain a threonine at position 19 suggesting that phosphorylation could be Thr19/Ser23.
Product Details
Description Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta with N terminal Myc tag.
NCBI Ref Seq NM_010908.4
RefSeq ORF Size 1080 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.