Online Inquiry
Nfkbib cDNA ORF Clone, Mouse, N-FLAG tag
SPD-10718
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | NF-κB Inhibitor |
Gene Abbr. | Nfkbib |
Gene ID | 18036 |
Full Name | nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta |
Alias | I(Kappa)B(beta), I-kappa-B-beta, IKB-beta, IKapp, IKappaBbeta |
Introduction | The NF-κB/Rel transcription factors are present in the cytosol in an inactive state complexed with the inhibitory IκB proteins. Activation occurs via phosphorylation of IκBα at Ser32 and Ser36 followed by proteasome-mediated degradation that results in the release and nuclear translocation of active NF-κB. IκBα phosphorylation and resulting Rel-dependent transcription are activated by a highly diverse group of extracellular signals including inflammatory cytokines, growth factors, and chemokines. Kinases that phosphorylate IκB at these activating sites have been identified.The regulation of IκBβ and IκBε is similar to that of IκBα. However, the phosphorylation and ubiquitin-mediated degradation of these proteins occurs with much slower kinetics. IKK phosphorylation of IκBβ occurs at Ser19 and Ser23, while IκBε can be phosphorylated at Ser18 and Ser22. The human sequence of IκB-β has also been reported to contain a threonine at position 19 suggesting that phosphorylation could be Thr19/Ser23. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta with N terminal Flag tag. |
NCBI Ref Seq | NM_010908.4 |
RefSeq ORF Size | 1080 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.