Nfkbia cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Nfkbia cDNA ORF Clone, Mouse, untagged

Nfkbia cDNA ORF Clone, Mouse, untagged

SPD-10703

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha.
Target Information
Species Mouse
Target Name NF-κB Inhibitor
Gene Abbr. Nfkbia
Gene ID 18035
Full Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha
Alias AI462015, Nfk, Nfkbi
Introduction The NF-κB/Rel transcription factors are present in the cytosol in an inactive state complexed with the inhibitory IκB proteins. Activation occurs via phosphorylation of IκBα at Ser32 and Ser36 followed by proteasome-mediated degradation that results in the release and nuclear translocation of active NF-κB. IκBα phosphorylation and resulting Rel-dependent transcription are activated by a highly diverse group of extracellular signals including inflammatory cytokines, growth factors, and chemokines. Kinases that phosphorylate IκB at these activating sites have been identified.
Product Details
Description Full length Clone DNA of Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha.
NCBI Ref Seq NM_010907.2
RefSeq ORF Size 945 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.