Online Inquiry
NFKBIA cDNA ORF Clone, Human, untagged
SPD-10713
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | NF-κB Inhibitor |
| Gene Abbr. | NFKBIA |
| Gene ID | 4792 |
| Full Name | NFKB inhibitor alpha |
| Alias | EDAID2, IKBA, MAD-3, NFKBI |
| Introduction | The NF-κB/Rel transcription factors are present in the cytosol in an inactive state complexed with the inhibitory IκB proteins. Activation occurs via phosphorylation of IκBα at Ser32 and Ser36 followed by proteasome-mediated degradation that results in the release and nuclear translocation of active NF-κB. IκBα phosphorylation and resulting Rel-dependent transcription are activated by a highly diverse group of extracellular signals including inflammatory cytokines, growth factors, and chemokines. Kinases that phosphorylate IκB at these activating sites have been identified. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha. |
| NCBI Ref Seq | NM_020529 |
| RefSeq ORF Size | 954 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutation: 81 C/T not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 0.95kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.