Online Inquiry
NFKB2 Knockout Cell Line
SPL-02281
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | NF-κB |
| Gene Abbr. | NFKB2 |
| Gene ID | 4791 |
| Full Name | nuclear factor kappa B subunit 2 |
| Alias | CVID10, H2TF1, LYT-10, LYT10, NF-kB2 |
| Species | Human |
| Genomic Locus | chr10:102396465 |
| Transcript | NM_001261403 |
| WT Expression Level | 37.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of NFKB2. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAGGCTGTTCCACGATCACC |
| PCR Primer |
Forward: GAAACAGGTCAGCAAGTTCACTAAC Reverse: TAGTAGCATTGTGATCAGGGAAGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.