NFKB2 Knockout Cell Line - CD BioSciences

service-banner

NFKB2 Knockout Cell Line

NFKB2 Knockout Cell Line

SPL-02280

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name NF-κB
Gene Abbr. NFKB2
Gene ID 4791
Full Name nuclear factor kappa B subunit 2
Alias CVID10, H2TF1, LYT-10, LYT10, NF-kB2
Species Human
Genomic Locus chr10:102396465
Transcript NM_001261403
WT Expression Level 37.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of NFKB2.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TAGGCTGTTCCACGATCACC
PCR Primer Forward: GAAACAGGTCAGCAAGTTCACTAAC
Reverse: TAGTAGCATTGTGATCAGGGAAGAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.