Online Inquiry
NFKB1 Knockout Cell Line
SPL-02279
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 67bp insertion |
| Target Information | |
|---|---|
| Target Name | NF-κB |
| Gene Abbr. | NFKB1 |
| Gene ID | 4790 |
| Full Name | nuclear factor kappa B subunit 1 |
| Alias | CVID12, EBP-1, KBF1, NF-kB, NF-kB1 |
| Species | Human |
| Genomic Locus | chr4:102537875 |
| Transcript | NM_003998 |
| WT Expression Level | 17.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 67bp insertion in a coding exon of NFKB1. |
| Description | 67bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATGGGCCTTCACATACATAA |
| PCR Primer |
Forward: GGGAAAAGTGATTCTTGTTTACGGA Reverse: ATCATGTGAACACTTCAGCTTAGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.