Online Inquiry
NFkB1 cDNA ORF Clone, Human, N-Myc tag
SPD-10658
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | NF-κB |
| Gene Abbr. | NFkB1 |
| Gene ID | 4790 |
| Full Name | nuclear factor kappa B subunit 1 |
| Alias | CVID12, EBP-1, KBF1, NF-kB, NF-kB1 |
| Introduction | Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.Following IKK-mediated phosphorylation of p105 NF-κB1 at multiple sites (Ser921, 923, 927, and 932) on its carboxy-terminus, SCFβ-TrCP mediated processing produces the 50 kDa active form p50. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with N terminal Myc tag. |
| NCBI Ref Seq | NM_001165412.1 |
| RefSeq ORF Size | 2907 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.