NFkB1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

NFkB1 cDNA ORF Clone, Human, N-HA tag

NFkB1 cDNA ORF Clone, Human, N-HA tag

SPD-10659

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with N terminal HA tag.
Target Information
Species Human
Target Name NF-κB
Gene Abbr. NFkB1
Gene ID 4790
Full Name nuclear factor kappa B subunit 1
Alias CVID12, EBP-1, KBF1, NF-kB, NF-kB1
Introduction Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.Following IKK-mediated phosphorylation of p105 NF-κB1 at multiple sites (Ser921, 923, 927, and 932) on its carboxy-terminus, SCFβ-TrCP mediated processing produces the 50 kDa active form p50.
Product Details
Description Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) with N terminal HA tag.
NCBI Ref Seq NM_001165412.1
RefSeq ORF Size 2949 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1182T/C not causing the amino acid variation.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + NotI (6kb + 2.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.