NFATC1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

NFATC1 cDNA ORF Clone, Human, untagged

NFATC1 cDNA ORF Clone, Human, untagged

SPD-10640

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1.
Target Information
Species Human
Target Name NFAT2
Gene Abbr. NFATC1
Gene ID 4772
Full Name nuclear factor of activated T cells 1
Alias NF-ATC, NF-ATc1.2, NFAT2, NFATc
Introduction The NFAT (nuclear factor of activated T cells) family of proteins consists of NFAT1 (NFATc2 or NFATp), NFAT2 (NFATc1 or NFATc), NFAT3 (NFATc4), and NFAT4 (NFATc3 or NFATx). All members of this family are transcription factors with a Rel homology domain and regulate gene transcription in concert with AP-1 (Jun/Fos) to orchestrate an effective immune response. NFAT proteins are predominantly expressed in cells of the immune system, but are also expressed in skeletal muscle, keratinocytes, and adipocytes, regulating cell differentiation programs in these cells. In resting cells, NFAT proteins are heavily phosphorylated and localized in the cytoplasm. Increased intracellular calcium concentrations activate the calcium/calmodulin-dependent serine phosphatase calcineurin, which dephosphorylates NFAT proteins, resulting in their subsequent translocation to the nucleus. Termination of NFAT signaling occurs upon declining calcium concentrations and phosphorylation of NFAT by kinases such as GSK-3 or CK1. Cyclosporin A and FK506 are immunosuppressive drugs that inhibit calcineurin and thus retain NFAT proteins in the cytoplasm.
Product Details
Description Full length Clone DNA of Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1.
NCBI Ref Seq BC112243
RefSeq ORF Size 2151 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.15kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.