Online Inquiry
NFATC1 cDNA ORF Clone, Human, C-His tag
SPD-10632
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | NFAT2 |
Gene Abbr. | NFATC1 |
Gene ID | 4772 |
Full Name | nuclear factor of activated T cells 1 |
Alias | NF-ATC, NF-ATc1.2, NFAT2, NFATc |
Introduction | The NFAT (nuclear factor of activated T cells) family of proteins consists of NFAT1 (NFATc2 or NFATp), NFAT2 (NFATc1 or NFATc), NFAT3 (NFATc4), and NFAT4 (NFATc3 or NFATx). All members of this family are transcription factors with a Rel homology domain and regulate gene transcription in concert with AP-1 (Jun/Fos) to orchestrate an effective immune response. NFAT proteins are predominantly expressed in cells of the immune system, but are also expressed in skeletal muscle, keratinocytes, and adipocytes, regulating cell differentiation programs in these cells. In resting cells, NFAT proteins are heavily phosphorylated and localized in the cytoplasm. Increased intracellular calcium concentrations activate the calcium/calmodulin-dependent serine phosphatase calcineurin, which dephosphorylates NFAT proteins, resulting in their subsequent translocation to the nucleus. Termination of NFAT signaling occurs upon declining calcium concentrations and phosphorylation of NFAT by kinases such as GSK-3 or CK1. Cyclosporin A and FK506 are immunosuppressive drugs that inhibit calcineurin and thus retain NFAT proteins in the cytoplasm. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 with C terminal His tag. |
NCBI Ref Seq | BC112243 |
RefSeq ORF Size | 2151 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.