NEK7 Knockout Cell Line - CD BioSciences

service-banner

NEK7 Knockout Cell Line

NEK7 Knockout Cell Line

SPL-02275

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name NEK7
Gene Abbr. NEK7
Gene ID 140609
Full Name NIMA related kinase 7
Species Human
Genomic Locus chr1:198253126
Transcript NM_133494
WT Expression Level 16.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction NIMA-related kinases share high amino acid sequence identity with the gene product of the Aspergillus nidulans 'never in mitosis A' gene, which controls initiation of mitosis.[supplied by OMIM, Jul 2002].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of NEK7.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence TTATAGAGCAGCCTGTCTCT
PCR Primer Forward: GATGTCTGCAAACTTACCCTATGTG
Reverse: CAATCTTTCCCAGCATTCTCAACTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.