Online Inquiry
NEK2 Knockout Cell Line
SPL-02271
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 25bp deletion |
| Target Information | |
|---|---|
| Target Name | NEK2 |
| Gene Abbr. | NEK2 |
| Gene ID | 4751 |
| Full Name | NIMA related kinase 2 |
| Alias | HsPK21, NEK2A, NLK1, PPP1R111, RP67 |
| Species | Human |
| Genomic Locus | chr1:211673620 |
| Transcript | NM_002497 |
| WT Expression Level | 29.32 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of NEK2. |
| Description | 25bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGTCATACCGTATTGCATC |
| PCR Primer |
Forward: GAGACATGTAATAAGGTGTGCCAAC Reverse: ACTGCTTTGGTTTTAGGCAATACTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.