Online Inquiry
NEDD4 Knockout Cell Line
SPL-02265
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | NEDD4 |
| Gene Abbr. | NEDD4 |
| Gene ID | 4734 |
| Full Name | NEDD4 E3 ubiquitin protein ligase |
| Alias | NEDD4-1, RPF1 |
| Species | Human |
| Genomic Locus | chr15:55862956 |
| Transcript | NM_006154 |
| WT Expression Level | 8.38 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is the founding member of the NEDD4 family of HECT ubiquitin ligases that function in the ubiquitin proteasome system of protein degradation. The encoded protein contains an N-terminal calcium and phospholipid binding C2 domain followed by multiple tryptophan-rich WW domains and, a C-terminal HECT ubiquitin ligase catalytic domain. It plays critical role in the regulation of a number of membrane receptors, endocytic machinery components and the tumor suppressor PTEN. [provided by RefSeq, Jul 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of NEDD4. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTACATAATAGGTCCTTCCA |
| PCR Primer |
Forward: AGTCCTGGGCAATAAAAATCCTAGT Reverse: GTAAACTTAATTGCTGCCATCCTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.