NEDD4 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

NEDD4 cDNA ORF Clone, Human, C-His tag

NEDD4 cDNA ORF Clone, Human, C-His tag

SPD-10622

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human neural precursor cell expressed, developmentally down-regulated 4
Target Information
Species Human
Target Name NEDD4
Gene Abbr. NEDD4
Gene ID 4734
Full Name NEDD4 E3 ubiquitin protein ligase
Alias NEDD4-1, RPF1
Introduction Neural precursor expressed, developmentally down-regulated protein 4 (NEDD4) was originally identified as a gene that is highly expressed in the early mouse embryonic central nervous system. Subsequently, a family of NEDD4-like proteins have been defined that includes seven members in humans. NEDD4 and NEDD4-like (NEDD4L) proteins contain multiple functional domains including a calcium-dependent phospholipid and membrane binding domain (C2 domain), two to four protein binding domains (WW domains), and an E3 ubiquitin-protein ligase domain (HECT domain). NEDD4 and NEDD4L have been shown to downregulate both neuronal voltage-gated Na+ channels (NaVs) and epithelial Na+ channels (ENaCs) in response to increased intracellular Na+ concentrations. The WW domains of NEDD4 bind to PY motifs (amino acid sequence PPXY) found in multiple NaV and ENaC proteins; ubiquitination of these proteins is mediated by the HECT domain of NEDD4 and results in their internalization and removal from the plasma membrane. Research studies have shown that mutation of the PY motifs in ENaC proteins is associated with Liddle's syndrome, an autosomal dominant form of hypertension. In addition to targeting sodium channels, NEDD4L has also been shown to negatively regulate TGF-β signaling by targeting Smad2 for degradation. Mouse and human NEDD4 are rapidly cleaved by caspase proteins during apoptosis, although the significance of this cleavage is not clear.
Product Details
Description Full length Clone DNA of Human neural precursor cell expressed, developmentally down-regulated 4
NCBI Ref Seq NM_006154.2
RefSeq ORF Size 2748 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2571T/G not causing the amino acid variation.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + NotI (6kb + 2.75kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.