Online Inquiry
NCOR2 cDNA ORF Clone, Human, untagged
SPD-13925
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human nuclear receptor corepressor 2 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SMRT |
| Gene Abbr. | NCOR2 |
| Gene ID | 9612 |
| Full Name | nuclear receptor corepressor 2 |
| Alias | CTG26, N-CoR2, SMAP270, SMRT, SMRTE |
| Introduction | The most well characterized nuclear receptor corepressors are NCoR1 (nuclear receptor corepressor) and its close paralog NCoR2, also know as SMRT (silencing mediator for retinoic acid and thyroid hormone receptors). NCoR1 and SMRT function to transcriptionally silence various unliganded, DNA bound non-steroidal nuclear receptors by serving as a large molecular scaffold that bridges the receptors with multiple chromatin remodeling factors that repress nuclear receptor-mediated gene transcription, in part, through deacetylation of core histones surrounding target promoters. Indeed, the N-terminal portion of NCoR1 and SMRT possess multiple distinct transcriptional repression domains (RDs) responsible for the recruitment of additional components of the corepressor complex such as HDACs, mSin3, GPS2, and TBL1/TBLR1. In between the RDs lies a pair of potent repressor motifs known as SANT motifs (SWI3, ADA2, N-CoR, and TFIIIB), which recruit HDAC3 and histones to the repressor complex in order to enhance HDAC3 activity. The C-terminal portion of NCoR1 and SMRT contain multiple nuclear receptor interaction domains (NDs), each of which contains a conserved CoRNR box (or L/I-X-X-I/V-I) motif that allow for binding to various unliganded nuclear hormone receptors such as thyroid hormone (THR) and retinoic acid (RAR) receptors. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human nuclear receptor corepressor 2 |
| NCBI Ref Seq | NM_001077261.3 |
| RefSeq ORF Size | 7377 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 7.38kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.