Online Inquiry
NCOA4 Knockout Cell Line
SPL-02256
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 53bp insertion |
| Target Information | |
|---|---|
| Target Name | NCOA4 |
| Gene Abbr. | NCOA4 |
| Gene ID | 8031 |
| Full Name | nuclear receptor coactivator 4 |
| Alias | ARA70, ELE1, PTC3, RFG |
| Species | Human |
| Genomic Locus | chr10:46015204 |
| Transcript | NM_001145263 |
| WT Expression Level | 75.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 53bp insertion in a coding exon of NCOA4. |
| Description | 53bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCTTAGAAGCCGTGAGGTA |
| PCR Primer |
Forward: CAAGTTACCAAACAGCACTTGAGAT Reverse: ACTCACTATTCTTTGGGAAACATCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.