Online Inquiry
NANS Knockout Cell Line
SPL-02239
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | NANS |
| Gene Abbr. | NANS |
| Gene ID | 54187 |
| Full Name | N-acetylneuraminate synthase |
| Alias | HEL-S-100, SAS, SEMDCG, SEMDG |
| Species | Human |
| Genomic Locus | chr9:98056907 |
| Transcript | NM_018946 |
| WT Expression Level | 68.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an enzyme that functions in the biosynthetic pathways of sialic acids. In vitro, the encoded protein uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN), respectively; however, it exhibits much higher activity toward the Neu5Ac phosphate product. In insect cells, expression of this gene results in Neu5Ac and KDN production. This gene is related to the E. coli sialic acid synthase gene neuB, and it can partially restore sialic acid synthase activity in an E. coli neuB-negative mutant. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of NANS. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCATGCGCTTGGCTACGTCC |
| PCR Primer |
Forward: TAGTGAGGCTTTGGACCCCG Reverse: TCCGAAAACGGAACTGGCG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.