Online Inquiry
NAA80 Knockout Cell Line
SPL-02221
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 404bp insertion |
| Target Information | |
|---|---|
| Target Name | NAA80 |
| Gene Abbr. | NAA80 |
| Gene ID | 24142 |
| Full Name | N-alpha-acetyltransferase 80, NatH catalytic subunit |
| Alias | FUS-2, FUS2, HsNAAA80, NAT6 |
| Species | Human |
| Genomic Locus | chr3:50297070 |
| Transcript | NM_001200016 |
| WT Expression Level | 6.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 404bp insertion in a coding exon of NAT6. |
| Description | 404bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGTTCAGCACCCGTGACAGG |
| PCR Primer |
Forward: GTATAGAAGTGCACCTGGTCATGG Reverse: GATGCTTGTGCTGACCTCATCAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.