Online Inquiry
NAA60 Knockout Cell Line
SPL-02219
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | NAA60 |
| Gene Abbr. | NAA60 |
| Gene ID | 79903 |
| Full Name | N-alpha-acetyltransferase 60, NatF catalytic subunit |
| Alias | HAT4, NAT15, NatF, hNaa60 |
| Species | Human |
| Genomic Locus | chr16:3479477 |
| Transcript | NM_001083601 |
| WT Expression Level | 59.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an enzyme that localizes to the Golgi apparatus, where it transfers an acetyl group to the N-terminus of free proteins. This enzyme acts on histones, and its activity is important for chromatin assembly and chromosome integrity. Alternative splicing and the use of alternative promoters results in multiple transcript variants. The upstream promoter is located in a differentially methylated region (DMR) and undergoes imprinting; transcript variants originating from this position are expressed from the maternal allele. [provided by RefSeq, Nov 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of NAA60. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TATCACGATACCATGAGTCT |
| PCR Primer |
Forward: TTAGGTAGAGACTTAAGTGATGGGC Reverse: ACACACGTACGTACCTCTTTATGTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.