Myd88 cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Myd88 cDNA ORF Clone, Rat, N-Myc tag

Myd88 cDNA ORF Clone, Rat, N-Myc tag

SPD-10549

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat myeloid differentiation primary response 88 with N terminal Myc tag.
Target Information
Species Rat
Target Name MyD88
Gene Abbr. Myd88
Gene ID 301059
Full Name MYD88, innate immune signal transduction adaptor
Introduction Members of the Toll-like receptor (TLR) family, named for the closely related Toll receptor in Drosophila, play a pivotal role in innate immune responses. TLRs recognize conserved motifs found in various pathogens and mediate defense responses. Triggering of the TLR pathway leads to the activation of NF-κB and subsequent regulation of immune and inflammatory genes. The TLRs and members of the IL-1 receptor family share a conserved stretch of approximately 200 amino acids known as the Toll/Interleukin-1 receptor (TIR) domain. Upon activation, TLRs associate with a number of cytoplasmic adaptor proteins containing TIR domains, including myeloid differentiation factor 88 (MyD88), MyD88-adaptor-like/TIR-associated protein (MAL/TIRAP), Toll-receptor-associated activator of interferon (TRIF), and Toll-receptor-associated molecule (TRAM). This association leads to the recruitment and activation of IRAK1 and IRAK4, which form a complex with TRAF6 to activate TAK1 and IKK.Activation of IKK leads to the degradation of IκB, which normally maintains NF-κB in an inactive state by sequestering it in the cytoplasm.MyD88 was originally isolated as a myeloid differentiation primary response gene that is rapidly induced upon IL-6 stimulated differentiation of M1 myeloleukemic cells into macrophages. It contains an amino-terminal death domain separated from a carboxyl-terminal TIR domain and functions as an adaptor in TLR/IL-1 receptor signaling. The death domain of MyD88 mediates interactions with the IRAK complex triggering a signaling cascade that includes the activation of NF-κB.
Product Details
Description Full length Clone DNA of Rat myeloid differentiation primary response 88 with N terminal Myc tag.
NCBI Ref Seq NM_198130.1
RefSeq ORF Size 891 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.