Online Inquiry
MYD88 cDNA ORF Clone, Human, untagged
SPD-10555
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human myeloid differentiation primary response 88 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MyD88 |
| Gene Abbr. | MYD88 |
| Gene ID | 4615 |
| Full Name | MYD88 innate immune signal transduction adaptor |
| Alias | IMD68, MYD88D |
| Introduction | Members of the Toll-like receptor (TLR) family, named for the closely related Toll receptor in Drosophila, play a pivotal role in innate immune responses. TLRs recognize conserved motifs found in various pathogens and mediate defense responses. Triggering of the TLR pathway leads to the activation of NF-κB and subsequent regulation of immune and inflammatory genes. The TLRs and members of the IL-1 receptor family share a conserved stretch of approximately 200 amino acids known as the Toll/Interleukin-1 receptor (TIR) domain. Upon activation, TLRs associate with a number of cytoplasmic adaptor proteins containing TIR domains, including myeloid differentiation factor 88 (MyD88), MyD88-adaptor-like/TIR-associated protein (MAL/TIRAP), Toll-receptor-associated activator of interferon (TRIF), and Toll-receptor-associated molecule (TRAM). This association leads to the recruitment and activation of IRAK1 and IRAK4, which form a complex with TRAF6 to activate TAK1 and IKK.Activation of IKK leads to the degradation of IκB, which normally maintains NF-κB in an inactive state by sequestering it in the cytoplasm.MyD88 was originally isolated as a myeloid differentiation primary response gene that is rapidly induced upon IL-6 stimulated differentiation of M1 myeloleukemic cells into macrophages. It contains an amino-terminal death domain separated from a carboxyl-terminal TIR domain and functions as an adaptor in TLR/IL-1 receptor signaling. The death domain of MyD88 mediates interactions with the IRAK complex triggering a signaling cascade that includes the activation of NF-κB. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human myeloid differentiation primary response 88 |
| NCBI Ref Seq | NM_001172566.1 |
| RefSeq ORF Size | 480 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.